Yeast Two-Hybrid System for Studying Protein 冷泉港
来源：百度文库 编辑：神马文学网 时间：2024/10/07 00:26:28
Cite as: Cold Spring Harb. Protoc.; 2010; doi:10.1101/pdb.prot5429
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 1: Construction and Characterization of a Bait Protein
Ilya Serebriiskii
Adapted fromProtein-Protein Interactions, 2nd edition (ed. Golemis and Adams). CSHL Press, Cold Spring Harbor, NY, USA, 2005.
INTRODUCTION
An important element in the characterization of the function of a protein is the identification of other proteins with which it interacts. A powerful genetic strategy for this purpose, termed the yeast two-hybrid system, uses transcriptional reporters in yeast to indirectly reflect the interaction between two proteins. The term two-hybrid derives from the two classes of chimeric, or "hybrid," proteins used in each screen. The first, commonly referred to as the "bait," is a fusion of a protein of interest "x" with a DNA-binding domain (DBD-x). The second, sometimes called the "prey," is a fusion of a cDNA library "y" to a transcriptional activation domain (AD-y). Together, DBD-x and AD-y provide the basis of the detection system. The two-hybrid approach has gained wide popularity because of the relative ease and speed with which it can be used to identify novel protein-protein interactions and to analyze known interactions. In stage 1 of the method, detailed in this protocol, characterization of a novel bait is described, with attention to controls that increase the chance of the bait functioning in a two-hybrid screen.
RELATED INFORMATION
The yeast two-hybrid system was first described byFields and Song (1989); subsequent work was performed by several independent groups to increase the power of the system for library screening (Chien et al. 1991;Durfee et al. 1993;Gyuris et al. 1993;Vojtek et al. 1993).Figure 1 shows the interaction of DBD-x (bait) and AD-y (prey): Coexpression in yeast of the two interacting hybrid proteins, with a suitable reporter containing binding sites for DBD-x in its promoter region, moves the AD-y activation domain to a position from which it can activate the reporter’s transcription.
View larger version (13K):
[in this window]
[in a new window]
Figure 1. Schematic of the basic two-hybrid system to detect interactions between two proteins in a yeast cell. As shown, a DNA-binding domain (DBD)-fused bait protein of interest interacts with an activation domain (Act) fused to a partner protein (Prey), either known or selected from a cDNA library. The interacting pair binds a specific sequence motif (op [operator] or UAS [upstream activating sequence], depending on whether LexA or GAL4 is used as a DBD), activating transcription of two separate reporter genes. (Reprinted fromSambrook and Russell 2001.)
Protocols for stages 2-4 of the method are described inYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library (Serebriiskii 2010a),Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen for Interacting Proteins (Serebriiskii 2010b), andYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 4: Isolation of Library Plasmid Insert and Second Confirmation of Positive Interactions (Serebriiskii 2010c). A flowchart illustrating the order and approximate time necessary to perform various steps is shown inFigure 2 . For additional protocols describing two-hybrid systems, seeThe Bacterial Two-Hybrid System as a Reporter System for Analyzing Protein-Protein Interactions (Giesecke and Joung 2007),Two-Hybrid Systems (Sambrook and Russell 2006a),Two-Hybrid Systems--Stage 1: Characterization of a Bait-LexA Fusion Protein (Sambrook and Russell 2006b), andTwo-Hybrid Systems-- Stage 2: Selecting an Interactor (Sambrook and Russell 2006c). A protocol forSDS-Polyacrylamide Gel Electrophoresis of Proteins (Sambrook and Russell 2006d) is also available.
View larger version (24K):
[in this window]
[in a new window]
Figure 2. A flowchart of the yeast two-hybrid system, including controls and library screening.
MATERIALS
Reagents
Agarose, low-melting-temperature (1% in 100 mM KHPO4 [pH 7.0])
Antibody (anti-LexA) (monoclonal [Santa Cruz] or polyclonal [Invitrogen])
Choose the appropriate medium for this protocol from the recipe table.
For an estimation of the amount of medium required for a typical experiment, see Table 18-3 inSambrook and Russell (2001).
DNA encoding the protein of interest (bait)
Reagents for blotting and Western analysis using standard protocols (seeHarlow and Lane 1988;Sambrook and Russell 2001)
Reagents for yeast transformation (see Step 2 andYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library [Serebriiskii 2010a], Steps 1-10)
Saccharomyces cerevisiae for selection and propagation of vectors (SKY48 lexAop-LEU2) (seeTable 1)
SDS polyacrylamide gel (seeSDS-Polyacrylamide Gel Electrophoresis of Proteins [Sambrook and Russell 2006d] for reagents and preparation)
Vectors carrying LexA fusion sequences (e.g., pMW103), control plasmids (e.g., pEG202-Ras), and LacZ reporter plasmids (seeTable 1)
Equipment
Equipment forSDS-Polyacrylamide Gel Electrophoresis of Proteins (Sambrook and Russell 2006d), blotting, and Western analysis using standard protocols (Harlow and Lane [1988];Sambrook and Russell 2001)
Equipment for yeast transformation (see Step 2 andYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library [Serebriiskii 2010a], Steps 1-10)
Fume hood
Gloves
Heat block preset to 100°C or boiling water bath
Another alternative is to use a polymerase chain reaction (PCR) machine (see Step 12).
Incubator preset to 30°C
Inoculating manifold replicator/frogger (e.g., Dan-Kar, or Bel-Blotter [Bel-Art Products] cut in half)
A frogger for the transfer of multiple colonies can be purchased or easily homemade; it is important that all of the spokes have a flat surface and that the spoke ends are level. The frogger can be sterilized by autoclaving or by flaming in alcohol.
Microcentrifuge
Micropipettor
Pipette tips and insert grid from rack (e.g., Rainin RT series, 200-µL)
Pipettes
Plates (96-well microtiter)
Roller drum or other shaker at 30°C
Spectrophotometer
Tape
Toothpicks (sterile)
Tubes (50-mL conical, sterile)
Tubes (microcentrifuge, sterile)
Vortex mixer
METHOD
The first step in an interactor hunt is to construct a plasmid that expresses LexA fused to the protein of interest. This construct is used with a lexAop-lacZ reporter plasmid to cotransform a yeast strain containing a chromosomally integrated lexAop-LEU2 reporter gene. A series of control experiments is performed to establish that the bait protein is made as a stable protein in yeast, that it is capable of entering the nucleus and binding lexA operator sites (Fig. 3 ; repression assay), and that it does not activate transcription of the lexA operator-based reporter genes to any significant extent. Depending on the results of these controls, the bait may be used to screen a library directly using the initial test conditions. Alternatively, different combinations of reporter strains/plasmids can be used, or the bait can be modified according to the guidelines provided below.
View larger version (38K):
[in this window]
[in a new window]
Figure 3. Repression assay for DNA binding (Brent and Ptashne 1984). The plasmid pJK101 contains the UAS from the GAL1 gene, followed by LexA operators upstream of the lacZ coding sequence. Thus, yeast containing pJK101 will have significant β-galactosidase activity when grown on medium in which gal is the sole carbon source because of binding of endogenous yeast GAL4 to the UASGAL (top). LexA-fused proteins that are made, enter the nucleus, and bind the lexA operator sequences will block activation from the UASGAL, repressing β-galactosidase activity three- to fivefold (bottom). Note that on glucose X-gal medium, yeast containing JK101 should be white, because UASGAL transcription is repressed. (Reprinted fromGolemis and Serebriiskii 1998.)
The following protocol utilizes basic yeast media and transformation procedures. It is good practice to move expeditiously through the characterization steps described here. Although plasmids are retained for extended periods of time in yeast maintained on Parafilm-wrapped selective plates at 4°C, expressed protein levels will gradually drop, and results may become somewhat variable after more than ~2 wk of such maintenance. If delays are foreseen, the best options are either to repeat transformations with bait protein and lexAop-lacZ reporter before moving on to library screening (Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen For Interacting Proteins [Serebriiskii 2010b]), or to freeze (at –70°C) a stock of yeast transformed with bait and reporter that can be thawed prior to library screening.
Construction of Bait and Yeast Transformation
1. Using standard subcloning techniques, insert the DNA encoding the protein of interest into the polylinker of pMW103 (Fig. 4 ) (Watson et al. 1996) or other LexA fusion plasmid (Table 1) to make an in-frame protein fusion, incorporating a translational stop sequence at the carboxy-terminal end of the desired bait sequence.
View larger version (30K):
[in this window]
[in a new window]
Figure 4. LexA fusion vector. The strong ADH1 promoter is used to express bait proteins as fusions to the DNA-binding protein LexA. A number of restriction sites are available for insertion of coding sequences: Those shown in bold type are unique. The reading frame for insertion is GAATTCCCGGGGATCCGTCGACCATGGCGGCCGCTCGAGTCGACCTGCAGC. The sequence CGTCAGCAGAGC TCACCATTG can be used to design a primer (on lexA gene slightly upstream of the polylinker) to confirm the correct reading frame for LexA fusions. The plasmid contains the HIS3 selectable marker and the 2µ origin of replication to allow propagation in yeast and an antibiotic-resistance gene and the pBR origin of replication to allow propagation in E. coli. Sequence data are available for pEG202; in pMW101 and pMW103, AmpR was replaced with CmR and KmR, respectively (Watson et al. 1996). Only unique (in bold) and some selected sites are shown; sites in parentheses are specific for the AmpR gene. Maps, sequences, and polylinkers for interaction trap-compatible plasmids can be found online athttp://www.fccc.edu/research/labs/golemis/InteractionTrapInWork.html. (Reprinted fromGolemis and Serebriiskii 1998.)
When deciding how to construct a bait, remember that the assay depends on the ability of the bait to enter the nucleus, and requires the bait to be a transcriptional NON-activator. Obvious sequences that confer attachment to membranes, or sequences that are transcriptional activation domains, should be removed from the chosen protein. It is not entirely clear whether the strategy of using two-hybrid systems to find associating partners for proteins that are normally extracellular is generally successful; it should be regarded as extremely high risk.
2. Transform (by scaling down ~1:30 the transformation protocol in Steps 1-10 ofYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library [Serebriiskii 2010a]) the SKY48 lexAop-LEU2 selection strain of yeast using the following combinations of LexA fusion and lexAop LacZ plasmids:
Plate Plasmid combination Test/Control
a pBait + pMW109 Test for activation by bait alone
b pEG202-hsRPB7 + pMW109 Weak positive control for activation
c pSH17-4 + pMW109 Strong positive control for activation
d pEG202-Ras + pMW109 Negative control for activation
e pBait + pJK101 Test for repression
f pEG202-Ras + pJK101 Positive control for repression
g pGKS3 + pJK101 Negative control for repression
pGKS3 can be substituted by any other yeast HIS3-selectable plasmid NOT expressing LexA.
A description of the function of each of the plasmids is provided inTable 1.
Use of the two LexA fusions (pEG202-Ras, pSH17-4) as strong positive and negative controls allows a rough assessment of the transcriptional activation profile of LexA bait proteins. pMW103 itself (or related plasmid pEG202) is not a good negative control, because the peptide encoded by the uninterrupted polylinker sequence is itself capable of very weakly activating transcription.
pMW109 is a very sensitive lacZ reporter and will detect any potential ability to activate lacZ transcription. However, the LEU2 reporter in SKY48 is even more sensitive than the pMW109 reporter for some baits, so it is possible that a bait protein that gives little or no signal in a β-galactosidase assay may nevertheless permit some level of growth on –Leu medium.
3. Plate each transformation mixture on a separate Glu/CM–Ura–His plate. Incubate for 2-3 d at 30°C to select for yeast that contain plasmids.
If colonies are not apparent within 3-4 d, or if only a very small number of colonies are obtained (<20), results obtained in characterization experiments may not be typical, and transformation should be repeated.
Phenotypic Assessment of the Yeast Colonies
4. Use replica plating (Fig. 5 ) to assess the phenotype of the yeast colonies obtained in Step 3.
View larger version (45K):
[in this window]
[in a new window]
Figure 5. (a) Replica technique/gridding yeast. From transformation plates, pick each yeast colony (1-2 mm in diameter) to be tested and resuspend it in 50-75 µL of H2O in a well of a 96-well microtiter plate. If sterile toothpicks are used for picking colonies, they need to be removed immediately after resuspension of a colony to prevent absorption of the liquid. Plastic pipette tips can also be used (shown); placing an insert from a rack of pipette tips (e.g., Rainin RT series) over the top of the microtiter plate (not shown) helps to shake and remove all tips at once. A frogger for the transfer of multiple colonies can be purchased or easily homemade. Details of replica plating are in Step 4. When all yeast are resuspended, print as described in Step 5 on the appropriate plates. (b) Typical results. Patches obtained after printing of the yeast suspension on Gal/Raf/CM–Ura–His–Trp–Leu (bottom) and CM/Gal/Raf/XGal–Ura (top) plates. (1A-1G) SKY48 plus strongly activating LexA fusion; (2A-2G) SKY48 plus moderately activating LexA fusion; (3A-3G) SKY48 plus nonactivating LexA fusion. (Reprinted fromGolemis and Serebriiskii 1998.)
Typically, multiple independent colonies are assayed for each combination of plasmids. This is important because, for some baits, protein expression level is heterogeneous between independent colonies, with accompanying heterogeneity of apparent ability to activate transcription of the two reporters.
Earlier versions of these protocols have provided alternative means to assess lacZ activation (see, e.g.,Golemis et al. 1997;Golemis and Serebriiskii 1998), which have included the use of toothpicks to streak colonies on plates with X-gal incorporated in the medium. Although these approaches are certainly acceptable, we prefer the replicator-based overlay approach described here for a number of reasons. First, this approach is significantly faster than the other approaches, both in terms of transfer of colonies between plates, and in time of color development in the assay (usually hours with an overlay vs. 2-3 d on plates). Second, the assay is more sensitive, allowing the reliable detection of lower levels of β-galactosidase activity (Serebriiskii and Golemis 2000). Third, use of the overlay assay rather than growth on plates is less likely to result in the detection of false positives (Serebriiskii et al. 2000a). Finally, the use of an array format allows easy transition to automated scoring of β-galactosidase assays, for example, through the use of plate readers (Serebriiskii et al. 2000b).
i. Dispense 25-50 µL of H2O to each well of one-half (six x eight wells) of a 96-well microtiter plate, e.g., using a syringe-based repeater. Place an insert grid from a rack of pipette tips over the top of the microtiter plate and attach it with tape.
The holes in the insert grid should be placed exactly over the wells of the microtiter plate.
ii. Using sterile plastic pipette tips, pick six yeast colonies (1-2 mm in diameter) from each of the transformation plates A-G, and insert tips into the H2O-filled wells through the holes in the insert grid. Leave tips supported in the near-vertical position (by the insert grid) until all colonies have been picked.
iii. Swirl the plate gently to mix the yeast into suspension, then remove the sealing tape and lift the insert grid, thereby removing all of the tips at once.
iv. Put a suitable replicator/frogger in the plate; if yeast has already sedimented, shake the replicator in a circular movement, or vortex the whole plate at medium speed. Lift the replicator (which will now carry drops of liquid on its spokes) and put it on the surface of the solidified medium. Tilt it slightly in a circular movement, then lift the replicator and put it back in the plate (keep the correct orientation!). Make sure that all of the drops are left on the surface and are of approximately the same size.
If only one or two drops are missing, this is easy to correct by dropping ~3 µL of yeast suspension on the missing spots from the corresponding wells. If many drops are missing, the best strategy is to make sure that all of the spokes of the replicator are in good contact with liquid in the microtiter plate (it may be necessary to cut off the side protrusions on the edge spokes of the plastic replicator) and redo the whole plate.
v. Continue replicating by shuttling back and forth between microtiter and media plates.
5. Transfer yeast suspension onto the following plates:
Plate Number
Glu/CM–Ura–His 2
Gal/Raf/CM–Ura–His 1
Gal/Raf/CM–Ura–His–Leu 1
Gal/Raf/CM–Ura–His–Trp 1
Allow the liquid to adsorb to the agar before putting the plates upside down in a 30°C incubator.
For transfer between master plates, invert the frogger on the lab bench, and then place the master plate upside down on the spokes, making sure that a proper alignment of the spokes and the colonies is made. Lift the plate and insert the frogger into a microtiter plate with ~50 µL of H2O per well. Let the plate sit for 5-10 min, shaking from time to time to resuspend the cells left on the spokes.
Alternatively, rather than using extended shaking, wash the frogger and flame-sterilize it before printing to ensure that none of the spokes retains excess yeast.
6. Incubate at 30°C overnight (–Ura–His plates) before assaying for β-galactosidase activity (Step 7), or for 3-4 d (–Ura–His–Leu and –Ura–His–Trp plates) monitoring for growth. Be sure to save one Glu/CM–Ura–His plate (this will be the master plate).
At 48 h after plating on Gal/Raf/CM–Ura–His–Leu, C should have grown as well as on a Glu/CM–Ura–His master plate, whereas A, B, and D-G should show no growth; ideally, A will still display no apparent growth at 96 h after plating (see Step 2 for definition of A-G). The optional –Ura–His–Trp plate is a negative control for contamination: Nothing should grow here.
7. Assay β-galactosidase activity of the transformants by a chloroform overlay assay (adapted fromDuttweiler 1996):
i. Collect one Gal/Raf/CM–Ura–His plate and one Glu/CM–Ura–His plate with spotted yeast transformants. Gently overlay each plate with chloroform by pipetting it in slowly from the side so as not to smear colonies. Leave colonies completely covered for 5 min, then remove the chloroform by decanting.
Chloroform is toxic and should neither be inhaled nor come into contact with skin. Wear gloves and work in a chemical fume hood.
ii. Gently rinse the plates with another ~5 mL of chloroform and allow them to dry for a further 5 min in the fume hood.
iii. Cool 1% low-melting agarose in 100 mM KHPO4 (pH 7.0) to ~60°C. For each plate, take ~7 mL of the agarose and add X-gal to 0.25 mg/mL. Overlay the plate, making sure that all yeast spots are completely covered.
Plates will be chilled after chloroform evaporation, so it will be difficult to spread <7 mL of top agarose.
iv. Incubate at 30°C and monitor for color changes.
It is generally useful to check the plates after 20 min, and again after 1-3 h.
For the activation assay, strong activators such as the LexA-GAL4 control (pSH17-4) will produce a blue color in 5-10 min, and a bait protein (LexA fusion protein) that does so is likely to be unsuitable for use in an interactor hunt. Weak activators will produce a blue color in 1-6 h (compare with negative control pEG202-Ras and weak positive control pEG202-hsRPB7). Any bait activating more strongly than pEG202-hsRPB7 will probably not be suitable.
The repression assay should be monitored within 1-2 h if using the overlay assay, because the high basal LacZ activity will make differential activation of JK101 impossible to see with longer incubations. A good result (i.e., real repression) will generally reflect a two- to threefold reduction in the degree of blue color detected for JK101 + bait versus JK101 alone on plates containing galactose.
Expected results for a well-behaved bait are provided inTable 2. Of six colonies assayed for each transformation, in an optimal result, all six colonies would possess an approximately equivalent phenotype in activation and repression assays. For a small number of baits, this is not the case. The most typical deviation is that of six colonies assayed for a new bait; some will be white on X-gal and will not grow on –Leu medium, whereas the remaining fraction display some degree of blueness and growth. The white, nongrowing colonies should NOT be selected as the starting point in a library screen; generally, these colonies possess the phenotypes they do because they are synthesizing little or no bait protein (as can be assayed by Western blot, Step 14). The reasons for this are not clear; however, it appears to be a bait-specific phenomenon and may be linked to some degree of toxicity of continued expression of particular proteins in yeast. It will be necessary to adjust sensitivity levels to allow work with blue growing colonies.
For a small percentage of baits, the repression assay does not work, although the bait protein is clearly present at high levels, and there is no reason to believe it is not nuclear. In these cases, it is generally reasonable to go ahead with the library screen.
See Troubleshooting.
Detection of Bait Protein Expression
An important step in characterization of a bait protein is the direct assay of whether the bait is detectably expressed and whether the bait is of the correct size. In most cases, both of the above will be true; however, some proteins (especially where the fusion domain is ~60-80 kD or larger) will either be synthesized at low levels or be post-translationally clipped by yeast proteases. Either of these two outcomes can lead to problems in library screens. Proteins expressed at low levels, and apparently inactive in transcriptional activation assays, can be up-regulated to much higher levels under the leucine-deficient selection and suddenly demonstrate a high background of transcriptional activation. Where proteins are proteolytically clipped, screens might inadvertently be performed with LexA fused only to the amino-terminal end of the larger intended bait. To anticipate and forestall these potential problems, Western analysis of lysates of yeast containing LexA-fused baits is helpful.
8. Inoculate at least two primary transformants for each novel bait construct assayed, and for a positive control for protein expression (such as pEG202-Ras). Use a sterile toothpick to pick colonies from the Glu/CM–Ura–His master plate into Glu/CM–Ura–His liquid medium.
If you are wearing gloves, the toothpick can generally be dropped into the culture tube and left there without contamination.
9. Grow overnight cultures on a roller drum or other shaker at 30°C. In the morning, inoculate saturated cultures into fresh tubes containing ~2.5 mL of Glu/CM–Ura–His, with a starting density of OD600 ~0.2, and grow again as before.
10. When the culture has reached OD600 ~0.45-0.7 (~4-6 h), remove 1.5 mL to a microcentrifuge tube and centrifuge the cells at full speed for 3-5 min in a microcentrifuge. When the pellet is visible, decant/aspirate the supernatant.
For some LexA-fusion proteins, levels of the protein drop off rapidly in cultures approaching stationary phase. This is caused by a combination of the diminishing activity of the ADH1 promoter in late growth phases, and relative instability of particular fusion domains. Thus, it is not always a good idea to let cultures become saturated in the hopes of getting a higher yield of protein to assay (although for some proteins, this does work).
It may be helpful to freeze duplicate samples at this stage, if more than one round of assay is anticipated (and in case of accidents).
11. Working rapidly, add 50 µL of 2X SDS gel-loading buffer to the tube, vortex, and place the tube on dry ice.
At this stage, samples may be frozen at –70°C, and are stable for extended periods (at least 4-6 mo).
12. When ready to run a polyacrylamide gel, prior to Western analysis, transfer samples from the freezer directly to a boiling water bath or to a heating block or PCR machine set to 100°C. Boil for 5 min.
13. Chill on ice and centrifuge for 5-30 sec in a microcentrifuge to pellet large cell debris. Load ~20-50 µL per gel lane.
14. Perform polyacrylamide gel electrophoresis (PAGE) as described inSDS-Polyacrylamide Gel Electrophoresis of Proteins (Sambrook and Russell 2006d). Perform blotting and Western analysis using standard protocols (Harlow and Lane 1988;Sambrook and Russell 2001).
LexA fusions can be visualized using an antibody to the fusion domain, if available; alternatively, an antibody to LexA (commercially available) may be used. Use of antibodies to LexA is preferable,because this allows comparison of expression levels of the bait protein under test with other standard bait proteins, e.g., LexA-Ras.
See Troubleshooting.
15. Note which colonies on the master plate express bait appropriately and use one of these colonies as the founder to grow up for library introduction (Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen For Interacting Proteins [Serebriiskii 2010b]).
See Troubleshooting.
TROUBLESHOOTING
Problem: The bait activates transcription.
[Step 7.iv]
Solution: This problem can be addressed in several ways:
1. Make a series of truncations of the protein in an attempt to eliminate the activation domain. If the bait activates transcription very strongly, i.e., as well as the positive control, this step will probably be necessary.
2. If the bait activates moderately, the simplest approach is to repeat the control experiments using less-stringent reporter plasmids and strain (seeTables 2 and3), and see whether activation is reduced to minor levels. Alternatively, the protein can be truncated, as for a strong activator. Finally, it is possible to use an integrating form of bait vector (seeTable 2), which will result in a stable reduction of protein levels.
3. If the bait is a weak activator, one option is to use less-stringent reporter plasmids; alternatively, proceed with the tested reagents, assuming that a small background of false positives may be identified. In general, it is a good idea to use the most sensitive screening conditions possible; in some cases, use of very stringent interaction strains eliminates detection of biologically relevant interactions (Estojak et al. 1995).
Problem: The bait plasmid produces an inappropriate level or size of protein.
[Step 14]
Solution: This should not be underestimated as a possible source of problems. We reiterate, it is not uncommon for the bait to be present at steady state in yeast as a highly processed species after it has been "clipped" by intracellular proteases. If this is not detected (e.g., by Western blot) and a truncated form of the bait is used in the screen, aberrant or no interactors may be detected. Consider the following:
1. If the bait is very large and poorly expressed, the solution may be to subdivide it into two or three overlapping expression constructs, each of which can be tested independently.
2. In cases where the bait protein is correctly expressed, but at very low levels, concentration of the usable bait can be enhanced by expressing it from a vector containing a nuclear localization sequence, e.g., pJK202.
Problem: In the absence of selection, very few transformants containing the bait plasmid express the bait protein, or yeast expressing the bait protein grow noticeably more poorly than control yeast.
[Step 15]
Solution: Slow-growing transformants would suggest that the bait protein is somewhat toxic to the yeast. Because this can detrimentally affect the screening process, it may be desirable to express the protein using a vector that has an inducible promoter, e.g., pGilda (Shaywitz et al. 1997), which contains the GAL1 promoter (this would allow expression to be limited to the duration of the selection procedure). Note, however, that tests with a pGilda construct should be performed on medium containing galactose as a carbon source. Suggested modifications are summarized inTable 3. At this time, most of the alternative bait expression vectors remain on an AmpR selection for bacteria. If using them in their unmodified form, the investigator may need to use a KC8 bacterial passage to facilitate isolation of the library plasmid following a library screen.
REFERENCES
Brent R, Ptashne M. 1984. A bacterial repressor protein or a yeast transcriptional terminator can block upstream activation of a yeast gene. Nature 312: 612–615.[Medline] Chien CT, Bartel PL, Sternglanz R, Fields S. 1991. The two-hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest. Proc Nat Acad Sci 88: 9578–9582.[Abstract/Free Full Text] Durfee T, Becherer K, Chen PL, Yeh SH, Yang Y, Kilburn AE, Lee WH, Elledge SJ. 1993. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes & Dev 7: 555–569.[Abstract/Free Full Text] Duttweiler HM. 1996. A highly sensitive and non-lethal β-galactosidase plate assay for yeast. Trends Genet 12: 340–341.[Medline] Estojak J, Brent R, Golemis EA. 1995. Correlation of two-hybrid affinity data with in vitro measurements. Mol Cell Biol 15: 5820–5829.[Abstract/Free Full Text] Fields S, Song O. 1989. A novel genetic system to detect protein-protein interaction. Nature 340: 245–246.[Medline] Giesecke AV, Joung JK. 2007. The bacterial two-hybrid system as a reporter system for analyzing protein-protein interactions. Cold Spring Harb Protoc doi: 10.1101/pdb.prot4672.[Abstract/Free Full Text] Spector, et al. 1998. Two-hybrid systems/interaction trap. In Cells: A laboratory manual, pp. 69.1–69.40. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Golemis EA, Serebriiskii I, Gyuris J, Brent R. 1997. Interaction trap/two-hybrid system to identify interacting proteins. In Current protocols in molecular biology (eds. FM Ausubel et al.), pp. 20.21.21–20.21.35. Wiley, New York. Gyuris J, Golemis EA, Chertkov H, Brent R. 1993. Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75: 791–803.[Medline] Harlow E, Lane D. 1988. Antibodies: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook J, Russell D. 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook J, Russell D. 2006a. Two-hybrid systems. Cold Spring Harb Protoc doi: 10.1101/pdb.prot3889.[Free Full Text] Sambrook J, Russell D. 2006b. Two-hybrid systems--stage 1: Characterization of a bait-LexA fusion protein. Cold Spring Harb Protoc doi: 10.1101/pdb.prot3895.[Free Full Text] Sambrook J, Russell D. 2006c. Two-hybrid systems--stage 2: Selecting an interactor. Cold Spring Harb Protoc doi: 10.1101/pdb.prot3888.[Free Full Text] Sambrook J, Russell D. 2006d. SDS-polyacrylamide gel electrophoresis of proteins. Cold Spring Harb Protoc doi: 10.1101/pdb.prot4540.[Abstract/Free Full Text] Serebriiskii IG, Golemis EA. 2000. Uses of lacZ to study gene function: Evaluation of β-galactosidase assays employed in the yeast two-hybrid system. Anal Biochem 285: 1–15.[Medline] Serebriiskii I, Khazak V, Golemis EA. 1999. A two-hybrid dual bait system to discriminate specificity of protein interactions. J Biol Chem 274: 17080–17087.[Abstract/Free Full Text] Serebriiskii I, Estojak J, Berman M, Golemis EA. 2000a. Approaches to detecting two-hybrid false positives. Biotechniques 28: 328–336.[Medline] Serebriiskii IG, Toby GG, Golemis EA. 2000b. Streamlined yeast colorimetric reporter assays, using scanners and plate readers. Biotechniques 29: 278–279.[Medline] Serebriiskii IG. 2010a. Yeast two-hybrid system for studying protein-protein interactions--stage 2: Transforming and characterizing the library. Cold Spring Harb Protoc (this issue). doi: 10.1101/pdb.prot5430.[Abstract/Free Full Text] Serebriiskii IG. 2010b. Yeast two-hybrid system for studying protein-protein interactions--stage 3: Screen for interacting proteins. Cold Spring Harb Protoc (this issue). doi: 10.1101/pdb.prot5431.[Abstract/Free Full Text] Serebriiskii IG. 2010c. Yeast two-hybrid system for studying protein-protein interactions--stage 4: Isolation of library plasmid insert and second confirmation of positive interactions. Cold Spring Harb Protoc (this issue). doi: 10.1101/pdb.prot5432.[Abstract/Free Full Text] Shaywitz DA, Espenshade PJ, Gimeno RE, Kaiser CA. 1997. COPII subunit interactions in the assembly of the vesicle coat. J Biol Chem 272: 25413–25416.[Abstract/Free Full Text] Vojtek AB, Hollenberg SM, Cooper JA. 1993. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74: 205–214.[Medline] Watson MA, Buckholz R, Weiner MP. 1996. Vectors encoding alternative antibiotic resistance for use in the yeast two-hybrid system. Biotechniques 21: 255–259.[Medline]
Chloroform (CHCl3)
Chloroform (CHCl3) is irritating to the skin, eyes, mucous membranes, and respiratory tract. It is a carcinogen and may damage the liver and kidneys. It is also volatile. Avoid breathing the vapors. Wear appropriate gloves and safety glasses. Always use in a chemical fume hood.
DMF (N,N-Dimethylformamide, dimethylformamide, HCON[CH3]2)
DMF (N,N-dimethylformamide, dimethylformamide, HCON[CH3]2) is a possible carcinogen and is irritating to the eyes, skin, and mucous membranes. It can exert its toxic effects through inhalation, ingestion, or skin absorption. Chronic inhalation can cause liver and kidney damage. Wear appropriate gloves and safety glasses. Use in a chemical fume hood.
Dry ice (Carbon dioxide; CO2)
CO2 (carbon dioxide; dry ice) in all forms may be fatal by inhalation, ingestion, or skin absorption. In high concentrations, it can paralyze the respiratory center and cause suffocation. Use only in well-ventilated areas. In the form of dry ice, contact with carbon dioxide can also cause frostbite. Do not place large quantities of dry ice in enclosed areas such as cold rooms. Wear appropriate gloves and safety goggles.
CM selective media
Ingredients Glu/CM
–U–H
medium Glu/CM
–U–H
agar Glu/CM
–T
agar Glu/CM
–U–H–T
agar Glu/CM
–U–H–T–L
agar Gal/Raf
–U–H
agar Gal/Raf/CM
–U–H–L
agar Gal/Raf/CM
–U–H–T
medium Gal/Raf/CM
–U–H–T
agar Gal/Raf/CM
–U–H–T–L
agar
YNB 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g
Glucose 20 g 20 g 20 g 20 g 20 g -- -- -- -- --
Galactose + raffinose -- -- -- -- -- 20 g + 10 g 20 g + 10 g 20 g + 10 g 20 g + 10 g 20 g + 10 g
Leucine (L) (4 mg/mL) 15 mL 15 mL 15 mL 15 mL -- 15 mL -- 15 mL 15 mL --
Histidine (H) (4 mg/mL) -- -- 5 mL -- -- -- -- -- -- --
Tryptophan (T) (4 mg/mL) 10 mL 10 mL -- -- -- 10 mL 10 mL -- -- --
Uracil (U) (4 mg/mL) -- -- 5 mL -- -- -- -- -- -- --
Agar -- 20 g -- 20 g 20 g 20 g 20 g -- 20 g 20 g
To prepare medium or agar, mix the ingredients together in a final volume of 1 L of H2O. Autoclave for 20 min. Cool the medium to 50ºC before pouring plates (24 x 24 cm).
Yeast nitrogen base without amino acids (YNB) is sold either with or without ammonium sulfate. This recipe is for YNB with ammonium sulfate. If the bottle of YNB is lacking ammonium sulfate, add 5 g of ammonium sulfate and only 1.7 g of YNB.
Adapted from Sambrook and Russell (Sambrook J, Russell D. 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.).
SDS gel-loading buffer (2X)
20% (v/v) glycerol
Store the SDS gel-loading buffer without DTT at room temperature. Add DTT from a 1 M stock just before the buffer is used.
Table 1. Interaction trap-compatible two-hybrid system plasmids and strains
Plasmid name/source Selection Number of operators Comment/description
in yeast in E. coli
LexA fusion plasmids
pEG202 (pMW101, 103) HIS3 ApR ADH1 promoter expresses LexA followed by polylinker; basic plasmids to clone bait as LexA fusion. n.b.: E. coli marker for pMW101 is CmR, for pMW103, KmR.
pJK202 HIS3 ApR pEG202 derivative, incorporating nuclear localization sequences between LexA and polylinker (enhanced ability to translocate bait to nucleus)
pNLexA HIS3 ApR Polylinker is upstream of LexA; allows fusion of LexA to carboxyl terminus of bait, leaving amino-terminal residues of bait unblocked.
pGilda HIS3 ApR GAL1 promoter expresses LexA followed by polylinker, for use with baits whose continuous presence is toxic to yeast.
pEG202I HIS3 ApR pEG202 derivative, which can be integrated into yeast HIS3 gene after digestion with KpnI; ensures lower levels of bait expression
Reporter plasmids
pMW111 URA3 KmR 1 lexA lexA operators direct transcription of the lacZ gene: sensitivity to transcriptional activation is a function of operator number.
pMW109 URA3 KmR 2 lexA
pMW112 URA3 KmR 8 lexA
Activation domain fusion plasmids
pJG4-5, pYesTrp2 TRP1 ApR Library or prey expression plasmids; GAL1 promoter provides efficient expression of a gene fused to a cassette consisting of nuclear localization sequence, transcriptional activation domain, and HA or V5 epitope tags
Genotype
LEU2/LYS2 selection strains
SKY48 (MAT
3 cI Stringent selection for interaction partners of cI-fused baits; most sensitive lexA-responsive LEU2 reporter
SKY191 (MAT
3 cI Most stringent lexA-responsive LEU2 reporter; and more sensitive cI-responsive LYS2 reporter versus SKY48
SKY473 (MATa) 4 lexA
3 cI To be used as mating partner for SKY48 and SKY191 strains
Selection
in yeast in E. coli
Control set of plasmids: Testing specificity
pEG202-Ras HIS3 ApR Expresses LexA-Ras fusion protein; use as negative control for activation assay, positive control in repression assay, and as test bait in interaction assay
pEG202-hsRPB7 HIS3 ApR Expresses LexA-hsRPB7 fusion protein; use as weak positive control for activation assay.
pGKS3 HIS3 ApR Does not express any LexA-fusion protein; use as negative control for repression assay
pSH17-4 HIS3 ApR Expresses LexA-GAL4 fusion protein; use as strong positive control for activation assay
pJG4-5-Raf1 TRP1 ApR Raf interacts with Ras; control in interaction assay.
We note that SKY48 is described rather than EGY48 as host strain; this strain possesses additional features allowing the potential of adapting a two-hybrid screen to a two-bait two-hybrid screen, as described in Serebriiskii et al. (1999). Additional information on interaction trap-compatible reagents is provided online athttp://www.fccc.edu/research/labs/golemis/InteractionTrapInWork.html.
Table 2. Bait characterization: Expected results
Anticipated results
Assay Plasmids to transform X-gal plates Growth Leu-
Reporter LexA-fusion Glu Gal/Raf Gal/Raf
Activation:
Test pMW112 pBait (White/light blue) (White/light blue) (No)
Negative control pMW112 pEG202-Ras White White No
Weak positive control pMW112 pEG202-hsRPB7 Light blue Bluish No
Strong positive control pMW112 pSH17-4 Dark blue Blue Yes
Repression:
Test pJK101 pBait (White) (Lighter blue)
Negative control pJK101 pGKS3a White Blue No
Positive control pJK101 pEG202-Ras White Lighter blue
Test by Western blot
Expression:
Test Use clones from activation assay pBait (Single band)
Positive control 1 pEG202-Ras Single band ~45 kD
Positive control 2 pSH17-4 Single band ~35 kD
apGKS3 can be substituted for any other yeast HIS3 plasmid not expressing LexA.
(Adapted from Table 18-7, Sambrook and Russell 2001.)
Table 3. Possible modifications to enhance bait performance in specific applications
Bait problem: Strongly activating Weakly activating Not transported to the nucleus, or low expression level Continuous expression of LexA-fusion is toxic to yeast Bait protein requires unblocked amino-terminal end for function Bait protein expressed at high levels, unstable, or interacts promiscuously Potential new problema
Response:
Truncate/modify bait + – – – – – It may be necessary to subdivide bait into two or three overlapping constructs, each of which must be tested independently.
Use more stringent strain/reporter combination + + – – +? +? Use of very stringent interaction strains may eliminate detection of biologically relevant interactions.
Fuse to nuclear localization sequence pJK202 – – + – – –
Put LexA-fused protein under GAL1-inducible promoter pGilda +? – – + +? +? Can no longer use GAL-dependence of reporter phenotype to indicate cDNA-dependent interaction
Fuse LexA to the carboxyl terminus of the bait pNLexA – – – – + – Generally, LexA poorly tolerates attachment of the amino-terminal fusion domain; only ~60% of constructs are expressed correctly.
Integrate bait, reduce concentration pEG202I +? – – +? +? + Reduced bait protein concentration may lead to reduced assay sensitivity.
(+) Would usually help; (+?) may help; (–) will not help.
aAll of the alternative bait expression vectors remain on an AmpR selection for bacteria. If using them as is, the investigator may need to use a KC8 bacterial passage to isolate the library plasmid after a library screen.
Copyright © 2010 by Cold Spring Harbor Laboratory Press.Terms of Service. All rights reserved. Anyone using the procedures outlined in these protocols does so at their own risk. Cold Spring Harbor Laboratory makes no representations or warranties with respect to the material set forth in these protocols and has no liability in connection with their use. All materials used in these protocols, but not limited to those highlighted with the Warning icon, may be considered hazardous and should be used with caution. For a full listing of cautions,click here.
All rights reserved. No part of these pages, either text or images, may be used for any reason other than personal use. Reproduction, modification, storage in a retrieval system or retransmission, in any form or by any means-electronic, mechanical, or otherwise-for reasons other than personal use is strictly prohibited without prior written permission.
This article has been cited by other articles:
I. Serebriiskii
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library
Cold Spring Harb Protoc, May 1, 2010; 2010(5): 10.1101/pdb.prot5430.
[Abstract][Full Text]
I. Serebriiskii
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen for Interacting Proteins
Cold Spring Harb Protoc, May 1, 2010; 2010(5): 10.1101/pdb.prot5431.
[Abstract][Full Text]
I. Serebriiskii
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 4: Isolation of Library Plasmid Insert and Second Confirmation of Positive Interactions
Cold Spring Harb Protoc, May 1, 2010; 2010(5): 10.1101/pdb.prot5432.
[Abstract][Full Text]
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 1: Construction and Characterization of a Bait Protein
Ilya Serebriiskii
Adapted fromProtein-Protein Interactions, 2nd edition (ed. Golemis and Adams). CSHL Press, Cold Spring Harbor, NY, USA, 2005.
INTRODUCTION
An important element in the characterization of the function of a protein is the identification of other proteins with which it interacts. A powerful genetic strategy for this purpose, termed the yeast two-hybrid system, uses transcriptional reporters in yeast to indirectly reflect the interaction between two proteins. The term two-hybrid derives from the two classes of chimeric, or "hybrid," proteins used in each screen. The first, commonly referred to as the "bait," is a fusion of a protein of interest "x" with a DNA-binding domain (DBD-x). The second, sometimes called the "prey," is a fusion of a cDNA library "y" to a transcriptional activation domain (AD-y). Together, DBD-x and AD-y provide the basis of the detection system. The two-hybrid approach has gained wide popularity because of the relative ease and speed with which it can be used to identify novel protein-protein interactions and to analyze known interactions. In stage 1 of the method, detailed in this protocol, characterization of a novel bait is described, with attention to controls that increase the chance of the bait functioning in a two-hybrid screen.
RELATED INFORMATION
The yeast two-hybrid system was first described byFields and Song (1989); subsequent work was performed by several independent groups to increase the power of the system for library screening (Chien et al. 1991;Durfee et al. 1993;Gyuris et al. 1993;Vojtek et al. 1993).Figure 1 shows the interaction of DBD-x (bait) and AD-y (prey): Coexpression in yeast of the two interacting hybrid proteins, with a suitable reporter containing binding sites for DBD-x in its promoter region, moves the AD-y activation domain to a position from which it can activate the reporter’s transcription.
View larger version (13K):
[in this window]
[in a new window]
Figure 1. Schematic of the basic two-hybrid system to detect interactions between two proteins in a yeast cell. As shown, a DNA-binding domain (DBD)-fused bait protein of interest interacts with an activation domain (Act) fused to a partner protein (Prey), either known or selected from a cDNA library. The interacting pair binds a specific sequence motif (op [operator] or UAS [upstream activating sequence], depending on whether LexA or GAL4 is used as a DBD), activating transcription of two separate reporter genes. (Reprinted fromSambrook and Russell 2001.)
Protocols for stages 2-4 of the method are described inYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library (Serebriiskii 2010a),Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen for Interacting Proteins (Serebriiskii 2010b), andYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 4: Isolation of Library Plasmid Insert and Second Confirmation of Positive Interactions (Serebriiskii 2010c). A flowchart illustrating the order and approximate time necessary to perform various steps is shown inFigure 2 . For additional protocols describing two-hybrid systems, seeThe Bacterial Two-Hybrid System as a Reporter System for Analyzing Protein-Protein Interactions (Giesecke and Joung 2007),Two-Hybrid Systems (Sambrook and Russell 2006a),Two-Hybrid Systems--Stage 1: Characterization of a Bait-LexA Fusion Protein (Sambrook and Russell 2006b), andTwo-Hybrid Systems-- Stage 2: Selecting an Interactor (Sambrook and Russell 2006c). A protocol forSDS-Polyacrylamide Gel Electrophoresis of Proteins (Sambrook and Russell 2006d) is also available.
View larger version (24K):
[in this window]
[in a new window]
Figure 2. A flowchart of the yeast two-hybrid system, including controls and library screening.
MATERIALS
Reagents
Agarose, low-melting-temperature (1% in 100 mM KHPO4 [pH 7.0])
Antibody (anti-LexA) (monoclonal [Santa Cruz] or polyclonal [Invitrogen])
Choose the appropriate medium for this protocol from the recipe table.
For an estimation of the amount of medium required for a typical experiment, see Table 18-3 inSambrook and Russell (2001).
DNA encoding the protein of interest (bait)
Reagents for blotting and Western analysis using standard protocols (seeHarlow and Lane 1988;Sambrook and Russell 2001)
Reagents for yeast transformation (see Step 2 andYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library [Serebriiskii 2010a], Steps 1-10)
Saccharomyces cerevisiae for selection and propagation of vectors (SKY48 lexAop-LEU2) (seeTable 1)
SDS polyacrylamide gel (seeSDS-Polyacrylamide Gel Electrophoresis of Proteins [Sambrook and Russell 2006d] for reagents and preparation)
Vectors carrying LexA fusion sequences (e.g., pMW103), control plasmids (e.g., pEG202-Ras), and LacZ reporter plasmids (seeTable 1)
Equipment
Equipment forSDS-Polyacrylamide Gel Electrophoresis of Proteins (Sambrook and Russell 2006d), blotting, and Western analysis using standard protocols (Harlow and Lane [1988];Sambrook and Russell 2001)
Equipment for yeast transformation (see Step 2 andYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library [Serebriiskii 2010a], Steps 1-10)
Fume hood
Gloves
Heat block preset to 100°C or boiling water bath
Another alternative is to use a polymerase chain reaction (PCR) machine (see Step 12).
Incubator preset to 30°C
Inoculating manifold replicator/frogger (e.g., Dan-Kar, or Bel-Blotter [Bel-Art Products] cut in half)
A frogger for the transfer of multiple colonies can be purchased or easily homemade; it is important that all of the spokes have a flat surface and that the spoke ends are level. The frogger can be sterilized by autoclaving or by flaming in alcohol.
Microcentrifuge
Micropipettor
Pipette tips and insert grid from rack (e.g., Rainin RT series, 200-µL)
Pipettes
Plates (96-well microtiter)
Roller drum or other shaker at 30°C
Spectrophotometer
Tape
Toothpicks (sterile)
Tubes (50-mL conical, sterile)
Tubes (microcentrifuge, sterile)
Vortex mixer
METHOD
The first step in an interactor hunt is to construct a plasmid that expresses LexA fused to the protein of interest. This construct is used with a lexAop-lacZ reporter plasmid to cotransform a yeast strain containing a chromosomally integrated lexAop-LEU2 reporter gene. A series of control experiments is performed to establish that the bait protein is made as a stable protein in yeast, that it is capable of entering the nucleus and binding lexA operator sites (Fig. 3 ; repression assay), and that it does not activate transcription of the lexA operator-based reporter genes to any significant extent. Depending on the results of these controls, the bait may be used to screen a library directly using the initial test conditions. Alternatively, different combinations of reporter strains/plasmids can be used, or the bait can be modified according to the guidelines provided below.
View larger version (38K):
[in this window]
[in a new window]
Figure 3. Repression assay for DNA binding (Brent and Ptashne 1984). The plasmid pJK101 contains the UAS from the GAL1 gene, followed by LexA operators upstream of the lacZ coding sequence. Thus, yeast containing pJK101 will have significant β-galactosidase activity when grown on medium in which gal is the sole carbon source because of binding of endogenous yeast GAL4 to the UASGAL (top). LexA-fused proteins that are made, enter the nucleus, and bind the lexA operator sequences will block activation from the UASGAL, repressing β-galactosidase activity three- to fivefold (bottom). Note that on glucose X-gal medium, yeast containing JK101 should be white, because UASGAL transcription is repressed. (Reprinted fromGolemis and Serebriiskii 1998.)
The following protocol utilizes basic yeast media and transformation procedures. It is good practice to move expeditiously through the characterization steps described here. Although plasmids are retained for extended periods of time in yeast maintained on Parafilm-wrapped selective plates at 4°C, expressed protein levels will gradually drop, and results may become somewhat variable after more than ~2 wk of such maintenance. If delays are foreseen, the best options are either to repeat transformations with bait protein and lexAop-lacZ reporter before moving on to library screening (Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen For Interacting Proteins [Serebriiskii 2010b]), or to freeze (at –70°C) a stock of yeast transformed with bait and reporter that can be thawed prior to library screening.
Construction of Bait and Yeast Transformation
1. Using standard subcloning techniques, insert the DNA encoding the protein of interest into the polylinker of pMW103 (Fig. 4 ) (Watson et al. 1996) or other LexA fusion plasmid (Table 1) to make an in-frame protein fusion, incorporating a translational stop sequence at the carboxy-terminal end of the desired bait sequence.
View larger version (30K):
[in this window]
[in a new window]
Figure 4. LexA fusion vector. The strong ADH1 promoter is used to express bait proteins as fusions to the DNA-binding protein LexA. A number of restriction sites are available for insertion of coding sequences: Those shown in bold type are unique. The reading frame for insertion is GAATTCCCGGGGATCCGTCGACCATGGCGGCCGCTCGAGTCGACCTGCAGC. The sequence CGTCAGCAGAGC TCACCATTG can be used to design a primer (on lexA gene slightly upstream of the polylinker) to confirm the correct reading frame for LexA fusions. The plasmid contains the HIS3 selectable marker and the 2µ origin of replication to allow propagation in yeast and an antibiotic-resistance gene and the pBR origin of replication to allow propagation in E. coli. Sequence data are available for pEG202; in pMW101 and pMW103, AmpR was replaced with CmR and KmR, respectively (Watson et al. 1996). Only unique (in bold) and some selected sites are shown; sites in parentheses are specific for the AmpR gene. Maps, sequences, and polylinkers for interaction trap-compatible plasmids can be found online athttp://www.fccc.edu/research/labs/golemis/InteractionTrapInWork.html. (Reprinted fromGolemis and Serebriiskii 1998.)
When deciding how to construct a bait, remember that the assay depends on the ability of the bait to enter the nucleus, and requires the bait to be a transcriptional NON-activator. Obvious sequences that confer attachment to membranes, or sequences that are transcriptional activation domains, should be removed from the chosen protein. It is not entirely clear whether the strategy of using two-hybrid systems to find associating partners for proteins that are normally extracellular is generally successful; it should be regarded as extremely high risk.
2. Transform (by scaling down ~1:30 the transformation protocol in Steps 1-10 ofYeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library [Serebriiskii 2010a]) the SKY48 lexAop-LEU2 selection strain of yeast using the following combinations of LexA fusion and lexAop LacZ plasmids:
Plate Plasmid combination Test/Control
a pBait + pMW109 Test for activation by bait alone
b pEG202-hsRPB7 + pMW109 Weak positive control for activation
c pSH17-4 + pMW109 Strong positive control for activation
d pEG202-Ras + pMW109 Negative control for activation
e pBait + pJK101 Test for repression
f pEG202-Ras + pJK101 Positive control for repression
g pGKS3 + pJK101 Negative control for repression
pGKS3 can be substituted by any other yeast HIS3-selectable plasmid NOT expressing LexA.
A description of the function of each of the plasmids is provided inTable 1.
Use of the two LexA fusions (pEG202-Ras, pSH17-4) as strong positive and negative controls allows a rough assessment of the transcriptional activation profile of LexA bait proteins. pMW103 itself (or related plasmid pEG202) is not a good negative control, because the peptide encoded by the uninterrupted polylinker sequence is itself capable of very weakly activating transcription.
pMW109 is a very sensitive lacZ reporter and will detect any potential ability to activate lacZ transcription. However, the LEU2 reporter in SKY48 is even more sensitive than the pMW109 reporter for some baits, so it is possible that a bait protein that gives little or no signal in a β-galactosidase assay may nevertheless permit some level of growth on –Leu medium.
3. Plate each transformation mixture on a separate Glu/CM–Ura–His plate. Incubate for 2-3 d at 30°C to select for yeast that contain plasmids.
If colonies are not apparent within 3-4 d, or if only a very small number of colonies are obtained (<20), results obtained in characterization experiments may not be typical, and transformation should be repeated.
Phenotypic Assessment of the Yeast Colonies
4. Use replica plating (Fig. 5 ) to assess the phenotype of the yeast colonies obtained in Step 3.
View larger version (45K):
[in this window]
[in a new window]
Figure 5. (a) Replica technique/gridding yeast. From transformation plates, pick each yeast colony (1-2 mm in diameter) to be tested and resuspend it in 50-75 µL of H2O in a well of a 96-well microtiter plate. If sterile toothpicks are used for picking colonies, they need to be removed immediately after resuspension of a colony to prevent absorption of the liquid. Plastic pipette tips can also be used (shown); placing an insert from a rack of pipette tips (e.g., Rainin RT series) over the top of the microtiter plate (not shown) helps to shake and remove all tips at once. A frogger for the transfer of multiple colonies can be purchased or easily homemade. Details of replica plating are in Step 4. When all yeast are resuspended, print as described in Step 5 on the appropriate plates. (b) Typical results. Patches obtained after printing of the yeast suspension on Gal/Raf/CM–Ura–His–Trp–Leu (bottom) and CM/Gal/Raf/XGal–Ura (top) plates. (1A-1G) SKY48 plus strongly activating LexA fusion; (2A-2G) SKY48 plus moderately activating LexA fusion; (3A-3G) SKY48 plus nonactivating LexA fusion. (Reprinted fromGolemis and Serebriiskii 1998.)
Typically, multiple independent colonies are assayed for each combination of plasmids. This is important because, for some baits, protein expression level is heterogeneous between independent colonies, with accompanying heterogeneity of apparent ability to activate transcription of the two reporters.
Earlier versions of these protocols have provided alternative means to assess lacZ activation (see, e.g.,Golemis et al. 1997;Golemis and Serebriiskii 1998), which have included the use of toothpicks to streak colonies on plates with X-gal incorporated in the medium. Although these approaches are certainly acceptable, we prefer the replicator-based overlay approach described here for a number of reasons. First, this approach is significantly faster than the other approaches, both in terms of transfer of colonies between plates, and in time of color development in the assay (usually hours with an overlay vs. 2-3 d on plates). Second, the assay is more sensitive, allowing the reliable detection of lower levels of β-galactosidase activity (Serebriiskii and Golemis 2000). Third, use of the overlay assay rather than growth on plates is less likely to result in the detection of false positives (Serebriiskii et al. 2000a). Finally, the use of an array format allows easy transition to automated scoring of β-galactosidase assays, for example, through the use of plate readers (Serebriiskii et al. 2000b).
i. Dispense 25-50 µL of H2O to each well of one-half (six x eight wells) of a 96-well microtiter plate, e.g., using a syringe-based repeater. Place an insert grid from a rack of pipette tips over the top of the microtiter plate and attach it with tape.
The holes in the insert grid should be placed exactly over the wells of the microtiter plate.
ii. Using sterile plastic pipette tips, pick six yeast colonies (1-2 mm in diameter) from each of the transformation plates A-G, and insert tips into the H2O-filled wells through the holes in the insert grid. Leave tips supported in the near-vertical position (by the insert grid) until all colonies have been picked.
iii. Swirl the plate gently to mix the yeast into suspension, then remove the sealing tape and lift the insert grid, thereby removing all of the tips at once.
iv. Put a suitable replicator/frogger in the plate; if yeast has already sedimented, shake the replicator in a circular movement, or vortex the whole plate at medium speed. Lift the replicator (which will now carry drops of liquid on its spokes) and put it on the surface of the solidified medium. Tilt it slightly in a circular movement, then lift the replicator and put it back in the plate (keep the correct orientation!). Make sure that all of the drops are left on the surface and are of approximately the same size.
If only one or two drops are missing, this is easy to correct by dropping ~3 µL of yeast suspension on the missing spots from the corresponding wells. If many drops are missing, the best strategy is to make sure that all of the spokes of the replicator are in good contact with liquid in the microtiter plate (it may be necessary to cut off the side protrusions on the edge spokes of the plastic replicator) and redo the whole plate.
v. Continue replicating by shuttling back and forth between microtiter and media plates.
5. Transfer yeast suspension onto the following plates:
Plate Number
Glu/CM–Ura–His 2
Gal/Raf/CM–Ura–His 1
Gal/Raf/CM–Ura–His–Leu 1
Gal/Raf/CM–Ura–His–Trp 1
Allow the liquid to adsorb to the agar before putting the plates upside down in a 30°C incubator.
For transfer between master plates, invert the frogger on the lab bench, and then place the master plate upside down on the spokes, making sure that a proper alignment of the spokes and the colonies is made. Lift the plate and insert the frogger into a microtiter plate with ~50 µL of H2O per well. Let the plate sit for 5-10 min, shaking from time to time to resuspend the cells left on the spokes.
Alternatively, rather than using extended shaking, wash the frogger and flame-sterilize it before printing to ensure that none of the spokes retains excess yeast.
6. Incubate at 30°C overnight (–Ura–His plates) before assaying for β-galactosidase activity (Step 7), or for 3-4 d (–Ura–His–Leu and –Ura–His–Trp plates) monitoring for growth. Be sure to save one Glu/CM–Ura–His plate (this will be the master plate).
At 48 h after plating on Gal/Raf/CM–Ura–His–Leu, C should have grown as well as on a Glu/CM–Ura–His master plate, whereas A, B, and D-G should show no growth; ideally, A will still display no apparent growth at 96 h after plating (see Step 2 for definition of A-G). The optional –Ura–His–Trp plate is a negative control for contamination: Nothing should grow here.
7. Assay β-galactosidase activity of the transformants by a chloroform overlay assay (adapted fromDuttweiler 1996):
i. Collect one Gal/Raf/CM–Ura–His plate and one Glu/CM–Ura–His plate with spotted yeast transformants. Gently overlay each plate with chloroform by pipetting it in slowly from the side so as not to smear colonies. Leave colonies completely covered for 5 min, then remove the chloroform by decanting.
Chloroform is toxic and should neither be inhaled nor come into contact with skin. Wear gloves and work in a chemical fume hood.
ii. Gently rinse the plates with another ~5 mL of chloroform and allow them to dry for a further 5 min in the fume hood.
iii. Cool 1% low-melting agarose in 100 mM KHPO4 (pH 7.0) to ~60°C. For each plate, take ~7 mL of the agarose and add X-gal to 0.25 mg/mL. Overlay the plate, making sure that all yeast spots are completely covered.
Plates will be chilled after chloroform evaporation, so it will be difficult to spread <7 mL of top agarose.
iv. Incubate at 30°C and monitor for color changes.
It is generally useful to check the plates after 20 min, and again after 1-3 h.
For the activation assay, strong activators such as the LexA-GAL4 control (pSH17-4) will produce a blue color in 5-10 min, and a bait protein (LexA fusion protein) that does so is likely to be unsuitable for use in an interactor hunt. Weak activators will produce a blue color in 1-6 h (compare with negative control pEG202-Ras and weak positive control pEG202-hsRPB7). Any bait activating more strongly than pEG202-hsRPB7 will probably not be suitable.
The repression assay should be monitored within 1-2 h if using the overlay assay, because the high basal LacZ activity will make differential activation of JK101 impossible to see with longer incubations. A good result (i.e., real repression) will generally reflect a two- to threefold reduction in the degree of blue color detected for JK101 + bait versus JK101 alone on plates containing galactose.
Expected results for a well-behaved bait are provided inTable 2. Of six colonies assayed for each transformation, in an optimal result, all six colonies would possess an approximately equivalent phenotype in activation and repression assays. For a small number of baits, this is not the case. The most typical deviation is that of six colonies assayed for a new bait; some will be white on X-gal and will not grow on –Leu medium, whereas the remaining fraction display some degree of blueness and growth. The white, nongrowing colonies should NOT be selected as the starting point in a library screen; generally, these colonies possess the phenotypes they do because they are synthesizing little or no bait protein (as can be assayed by Western blot, Step 14). The reasons for this are not clear; however, it appears to be a bait-specific phenomenon and may be linked to some degree of toxicity of continued expression of particular proteins in yeast. It will be necessary to adjust sensitivity levels to allow work with blue growing colonies.
For a small percentage of baits, the repression assay does not work, although the bait protein is clearly present at high levels, and there is no reason to believe it is not nuclear. In these cases, it is generally reasonable to go ahead with the library screen.
See Troubleshooting.
Detection of Bait Protein Expression
An important step in characterization of a bait protein is the direct assay of whether the bait is detectably expressed and whether the bait is of the correct size. In most cases, both of the above will be true; however, some proteins (especially where the fusion domain is ~60-80 kD or larger) will either be synthesized at low levels or be post-translationally clipped by yeast proteases. Either of these two outcomes can lead to problems in library screens. Proteins expressed at low levels, and apparently inactive in transcriptional activation assays, can be up-regulated to much higher levels under the leucine-deficient selection and suddenly demonstrate a high background of transcriptional activation. Where proteins are proteolytically clipped, screens might inadvertently be performed with LexA fused only to the amino-terminal end of the larger intended bait. To anticipate and forestall these potential problems, Western analysis of lysates of yeast containing LexA-fused baits is helpful.
8. Inoculate at least two primary transformants for each novel bait construct assayed, and for a positive control for protein expression (such as pEG202-Ras). Use a sterile toothpick to pick colonies from the Glu/CM–Ura–His master plate into Glu/CM–Ura–His liquid medium.
If you are wearing gloves, the toothpick can generally be dropped into the culture tube and left there without contamination.
9. Grow overnight cultures on a roller drum or other shaker at 30°C. In the morning, inoculate saturated cultures into fresh tubes containing ~2.5 mL of Glu/CM–Ura–His, with a starting density of OD600 ~0.2, and grow again as before.
10. When the culture has reached OD600 ~0.45-0.7 (~4-6 h), remove 1.5 mL to a microcentrifuge tube and centrifuge the cells at full speed for 3-5 min in a microcentrifuge. When the pellet is visible, decant/aspirate the supernatant.
For some LexA-fusion proteins, levels of the protein drop off rapidly in cultures approaching stationary phase. This is caused by a combination of the diminishing activity of the ADH1 promoter in late growth phases, and relative instability of particular fusion domains. Thus, it is not always a good idea to let cultures become saturated in the hopes of getting a higher yield of protein to assay (although for some proteins, this does work).
It may be helpful to freeze duplicate samples at this stage, if more than one round of assay is anticipated (and in case of accidents).
11. Working rapidly, add 50 µL of 2X SDS gel-loading buffer to the tube, vortex, and place the tube on dry ice.
At this stage, samples may be frozen at –70°C, and are stable for extended periods (at least 4-6 mo).
12. When ready to run a polyacrylamide gel, prior to Western analysis, transfer samples from the freezer directly to a boiling water bath or to a heating block or PCR machine set to 100°C. Boil for 5 min.
13. Chill on ice and centrifuge for 5-30 sec in a microcentrifuge to pellet large cell debris. Load ~20-50 µL per gel lane.
14. Perform polyacrylamide gel electrophoresis (PAGE) as described inSDS-Polyacrylamide Gel Electrophoresis of Proteins (Sambrook and Russell 2006d). Perform blotting and Western analysis using standard protocols (Harlow and Lane 1988;Sambrook and Russell 2001).
LexA fusions can be visualized using an antibody to the fusion domain, if available; alternatively, an antibody to LexA (commercially available) may be used. Use of antibodies to LexA is preferable,because this allows comparison of expression levels of the bait protein under test with other standard bait proteins, e.g., LexA-Ras.
See Troubleshooting.
15. Note which colonies on the master plate express bait appropriately and use one of these colonies as the founder to grow up for library introduction (Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen For Interacting Proteins [Serebriiskii 2010b]).
See Troubleshooting.
TROUBLESHOOTING
Problem: The bait activates transcription.
[Step 7.iv]
Solution: This problem can be addressed in several ways:
1. Make a series of truncations of the protein in an attempt to eliminate the activation domain. If the bait activates transcription very strongly, i.e., as well as the positive control, this step will probably be necessary.
2. If the bait activates moderately, the simplest approach is to repeat the control experiments using less-stringent reporter plasmids and strain (seeTables 2 and3), and see whether activation is reduced to minor levels. Alternatively, the protein can be truncated, as for a strong activator. Finally, it is possible to use an integrating form of bait vector (seeTable 2), which will result in a stable reduction of protein levels.
3. If the bait is a weak activator, one option is to use less-stringent reporter plasmids; alternatively, proceed with the tested reagents, assuming that a small background of false positives may be identified. In general, it is a good idea to use the most sensitive screening conditions possible; in some cases, use of very stringent interaction strains eliminates detection of biologically relevant interactions (Estojak et al. 1995).
Problem: The bait plasmid produces an inappropriate level or size of protein.
[Step 14]
Solution: This should not be underestimated as a possible source of problems. We reiterate, it is not uncommon for the bait to be present at steady state in yeast as a highly processed species after it has been "clipped" by intracellular proteases. If this is not detected (e.g., by Western blot) and a truncated form of the bait is used in the screen, aberrant or no interactors may be detected. Consider the following:
1. If the bait is very large and poorly expressed, the solution may be to subdivide it into two or three overlapping expression constructs, each of which can be tested independently.
2. In cases where the bait protein is correctly expressed, but at very low levels, concentration of the usable bait can be enhanced by expressing it from a vector containing a nuclear localization sequence, e.g., pJK202.
Problem: In the absence of selection, very few transformants containing the bait plasmid express the bait protein, or yeast expressing the bait protein grow noticeably more poorly than control yeast.
[Step 15]
Solution: Slow-growing transformants would suggest that the bait protein is somewhat toxic to the yeast. Because this can detrimentally affect the screening process, it may be desirable to express the protein using a vector that has an inducible promoter, e.g., pGilda (Shaywitz et al. 1997), which contains the GAL1 promoter (this would allow expression to be limited to the duration of the selection procedure). Note, however, that tests with a pGilda construct should be performed on medium containing galactose as a carbon source. Suggested modifications are summarized inTable 3. At this time, most of the alternative bait expression vectors remain on an AmpR selection for bacteria. If using them in their unmodified form, the investigator may need to use a KC8 bacterial passage to facilitate isolation of the library plasmid following a library screen.
REFERENCES
Brent R, Ptashne M. 1984. A bacterial repressor protein or a yeast transcriptional terminator can block upstream activation of a yeast gene. Nature 312: 612–615.[Medline] Chien CT, Bartel PL, Sternglanz R, Fields S. 1991. The two-hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest. Proc Nat Acad Sci 88: 9578–9582.[Abstract/Free Full Text] Durfee T, Becherer K, Chen PL, Yeh SH, Yang Y, Kilburn AE, Lee WH, Elledge SJ. 1993. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes & Dev 7: 555–569.[Abstract/Free Full Text] Duttweiler HM. 1996. A highly sensitive and non-lethal β-galactosidase plate assay for yeast. Trends Genet 12: 340–341.[Medline] Estojak J, Brent R, Golemis EA. 1995. Correlation of two-hybrid affinity data with in vitro measurements. Mol Cell Biol 15: 5820–5829.[Abstract/Free Full Text] Fields S, Song O. 1989. A novel genetic system to detect protein-protein interaction. Nature 340: 245–246.[Medline] Giesecke AV, Joung JK. 2007. The bacterial two-hybrid system as a reporter system for analyzing protein-protein interactions. Cold Spring Harb Protoc doi: 10.1101/pdb.prot4672.[Abstract/Free Full Text] Spector, et al. 1998. Two-hybrid systems/interaction trap. In Cells: A laboratory manual, pp. 69.1–69.40. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Golemis EA, Serebriiskii I, Gyuris J, Brent R. 1997. Interaction trap/two-hybrid system to identify interacting proteins. In Current protocols in molecular biology (eds. FM Ausubel et al.), pp. 20.21.21–20.21.35. Wiley, New York. Gyuris J, Golemis EA, Chertkov H, Brent R. 1993. Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75: 791–803.[Medline] Harlow E, Lane D. 1988. Antibodies: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook J, Russell D. 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook J, Russell D. 2006a. Two-hybrid systems. Cold Spring Harb Protoc doi: 10.1101/pdb.prot3889.[Free Full Text] Sambrook J, Russell D. 2006b. Two-hybrid systems--stage 1: Characterization of a bait-LexA fusion protein. Cold Spring Harb Protoc doi: 10.1101/pdb.prot3895.[Free Full Text] Sambrook J, Russell D. 2006c. Two-hybrid systems--stage 2: Selecting an interactor. Cold Spring Harb Protoc doi: 10.1101/pdb.prot3888.[Free Full Text] Sambrook J, Russell D. 2006d. SDS-polyacrylamide gel electrophoresis of proteins. Cold Spring Harb Protoc doi: 10.1101/pdb.prot4540.[Abstract/Free Full Text] Serebriiskii IG, Golemis EA. 2000. Uses of lacZ to study gene function: Evaluation of β-galactosidase assays employed in the yeast two-hybrid system. Anal Biochem 285: 1–15.[Medline] Serebriiskii I, Khazak V, Golemis EA. 1999. A two-hybrid dual bait system to discriminate specificity of protein interactions. J Biol Chem 274: 17080–17087.[Abstract/Free Full Text] Serebriiskii I, Estojak J, Berman M, Golemis EA. 2000a. Approaches to detecting two-hybrid false positives. Biotechniques 28: 328–336.[Medline] Serebriiskii IG, Toby GG, Golemis EA. 2000b. Streamlined yeast colorimetric reporter assays, using scanners and plate readers. Biotechniques 29: 278–279.[Medline] Serebriiskii IG. 2010a. Yeast two-hybrid system for studying protein-protein interactions--stage 2: Transforming and characterizing the library. Cold Spring Harb Protoc (this issue). doi: 10.1101/pdb.prot5430.[Abstract/Free Full Text] Serebriiskii IG. 2010b. Yeast two-hybrid system for studying protein-protein interactions--stage 3: Screen for interacting proteins. Cold Spring Harb Protoc (this issue). doi: 10.1101/pdb.prot5431.[Abstract/Free Full Text] Serebriiskii IG. 2010c. Yeast two-hybrid system for studying protein-protein interactions--stage 4: Isolation of library plasmid insert and second confirmation of positive interactions. Cold Spring Harb Protoc (this issue). doi: 10.1101/pdb.prot5432.[Abstract/Free Full Text] Shaywitz DA, Espenshade PJ, Gimeno RE, Kaiser CA. 1997. COPII subunit interactions in the assembly of the vesicle coat. J Biol Chem 272: 25413–25416.[Abstract/Free Full Text] Vojtek AB, Hollenberg SM, Cooper JA. 1993. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74: 205–214.[Medline] Watson MA, Buckholz R, Weiner MP. 1996. Vectors encoding alternative antibiotic resistance for use in the yeast two-hybrid system. Biotechniques 21: 255–259.[Medline]
Chloroform (CHCl3)
Chloroform (CHCl3) is irritating to the skin, eyes, mucous membranes, and respiratory tract. It is a carcinogen and may damage the liver and kidneys. It is also volatile. Avoid breathing the vapors. Wear appropriate gloves and safety glasses. Always use in a chemical fume hood.
DMF (N,N-Dimethylformamide, dimethylformamide, HCON[CH3]2)
DMF (N,N-dimethylformamide, dimethylformamide, HCON[CH3]2) is a possible carcinogen and is irritating to the eyes, skin, and mucous membranes. It can exert its toxic effects through inhalation, ingestion, or skin absorption. Chronic inhalation can cause liver and kidney damage. Wear appropriate gloves and safety glasses. Use in a chemical fume hood.
Dry ice (Carbon dioxide; CO2)
CO2 (carbon dioxide; dry ice) in all forms may be fatal by inhalation, ingestion, or skin absorption. In high concentrations, it can paralyze the respiratory center and cause suffocation. Use only in well-ventilated areas. In the form of dry ice, contact with carbon dioxide can also cause frostbite. Do not place large quantities of dry ice in enclosed areas such as cold rooms. Wear appropriate gloves and safety goggles.
CM selective media
Ingredients Glu/CM
–U–H
medium Glu/CM
–U–H
agar Glu/CM
–T
agar Glu/CM
–U–H–T
agar Glu/CM
–U–H–T–L
agar Gal/Raf
–U–H
agar Gal/Raf/CM
–U–H–L
agar Gal/Raf/CM
–U–H–T
medium Gal/Raf/CM
–U–H–T
agar Gal/Raf/CM
–U–H–T–L
agar
YNB 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g 6.7 g
Glucose 20 g 20 g 20 g 20 g 20 g -- -- -- -- --
Galactose + raffinose -- -- -- -- -- 20 g + 10 g 20 g + 10 g 20 g + 10 g 20 g + 10 g 20 g + 10 g
Leucine (L) (4 mg/mL) 15 mL 15 mL 15 mL 15 mL -- 15 mL -- 15 mL 15 mL --
Histidine (H) (4 mg/mL) -- -- 5 mL -- -- -- -- -- -- --
Tryptophan (T) (4 mg/mL) 10 mL 10 mL -- -- -- 10 mL 10 mL -- -- --
Uracil (U) (4 mg/mL) -- -- 5 mL -- -- -- -- -- -- --
Agar -- 20 g -- 20 g 20 g 20 g 20 g -- 20 g 20 g
To prepare medium or agar, mix the ingredients together in a final volume of 1 L of H2O. Autoclave for 20 min. Cool the medium to 50ºC before pouring plates (24 x 24 cm).
Yeast nitrogen base without amino acids (YNB) is sold either with or without ammonium sulfate. This recipe is for YNB with ammonium sulfate. If the bottle of YNB is lacking ammonium sulfate, add 5 g of ammonium sulfate and only 1.7 g of YNB.
Adapted from Sambrook and Russell (Sambrook J, Russell D. 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.).
SDS gel-loading buffer (2X)
20% (v/v) glycerol
Store the SDS gel-loading buffer without DTT at room temperature. Add DTT from a 1 M stock just before the buffer is used.
Table 1. Interaction trap-compatible two-hybrid system plasmids and strains
Plasmid name/source Selection Number of operators Comment/description
in yeast in E. coli
LexA fusion plasmids
pEG202 (pMW101, 103) HIS3 ApR ADH1 promoter expresses LexA followed by polylinker; basic plasmids to clone bait as LexA fusion. n.b.: E. coli marker for pMW101 is CmR, for pMW103, KmR.
pJK202 HIS3 ApR pEG202 derivative, incorporating nuclear localization sequences between LexA and polylinker (enhanced ability to translocate bait to nucleus)
pNLexA HIS3 ApR Polylinker is upstream of LexA; allows fusion of LexA to carboxyl terminus of bait, leaving amino-terminal residues of bait unblocked.
pGilda HIS3 ApR GAL1 promoter expresses LexA followed by polylinker, for use with baits whose continuous presence is toxic to yeast.
pEG202I HIS3 ApR pEG202 derivative, which can be integrated into yeast HIS3 gene after digestion with KpnI; ensures lower levels of bait expression
Reporter plasmids
pMW111 URA3 KmR 1 lexA lexA operators direct transcription of the lacZ gene: sensitivity to transcriptional activation is a function of operator number.
pMW109 URA3 KmR 2 lexA
pMW112 URA3 KmR 8 lexA
Activation domain fusion plasmids
pJG4-5, pYesTrp2 TRP1 ApR Library or prey expression plasmids; GAL1 promoter provides efficient expression of a gene fused to a cassette consisting of nuclear localization sequence, transcriptional activation domain, and HA or V5 epitope tags
Genotype
LEU2/LYS2 selection strains
SKY48 (MAT
3 cI Stringent selection for interaction partners of cI-fused baits; most sensitive lexA-responsive LEU2 reporter
SKY191 (MAT
3 cI Most stringent lexA-responsive LEU2 reporter; and more sensitive cI-responsive LYS2 reporter versus SKY48
SKY473 (MATa) 4 lexA
3 cI To be used as mating partner for SKY48 and SKY191 strains
Selection
in yeast in E. coli
Control set of plasmids: Testing specificity
pEG202-Ras HIS3 ApR Expresses LexA-Ras fusion protein; use as negative control for activation assay, positive control in repression assay, and as test bait in interaction assay
pEG202-hsRPB7 HIS3 ApR Expresses LexA-hsRPB7 fusion protein; use as weak positive control for activation assay.
pGKS3 HIS3 ApR Does not express any LexA-fusion protein; use as negative control for repression assay
pSH17-4 HIS3 ApR Expresses LexA-GAL4 fusion protein; use as strong positive control for activation assay
pJG4-5-Raf1 TRP1 ApR Raf interacts with Ras; control in interaction assay.
We note that SKY48 is described rather than EGY48 as host strain; this strain possesses additional features allowing the potential of adapting a two-hybrid screen to a two-bait two-hybrid screen, as described in Serebriiskii et al. (1999). Additional information on interaction trap-compatible reagents is provided online athttp://www.fccc.edu/research/labs/golemis/InteractionTrapInWork.html.
Table 2. Bait characterization: Expected results
Anticipated results
Assay Plasmids to transform X-gal plates Growth Leu-
Reporter LexA-fusion Glu Gal/Raf Gal/Raf
Activation:
Test pMW112 pBait (White/light blue) (White/light blue) (No)
Negative control pMW112 pEG202-Ras White White No
Weak positive control pMW112 pEG202-hsRPB7 Light blue Bluish No
Strong positive control pMW112 pSH17-4 Dark blue Blue Yes
Repression:
Test pJK101 pBait (White) (Lighter blue)
Negative control pJK101 pGKS3a White Blue No
Positive control pJK101 pEG202-Ras White Lighter blue
Test by Western blot
Expression:
Test Use clones from activation assay pBait (Single band)
Positive control 1 pEG202-Ras Single band ~45 kD
Positive control 2 pSH17-4 Single band ~35 kD
apGKS3 can be substituted for any other yeast HIS3 plasmid not expressing LexA.
(Adapted from Table 18-7, Sambrook and Russell 2001.)
Table 3. Possible modifications to enhance bait performance in specific applications
Bait problem: Strongly activating Weakly activating Not transported to the nucleus, or low expression level Continuous expression of LexA-fusion is toxic to yeast Bait protein requires unblocked amino-terminal end for function Bait protein expressed at high levels, unstable, or interacts promiscuously Potential new problema
Response:
Truncate/modify bait + – – – – – It may be necessary to subdivide bait into two or three overlapping constructs, each of which must be tested independently.
Use more stringent strain/reporter combination + + – – +? +? Use of very stringent interaction strains may eliminate detection of biologically relevant interactions.
Fuse to nuclear localization sequence pJK202 – – + – – –
Put LexA-fused protein under GAL1-inducible promoter pGilda +? – – + +? +? Can no longer use GAL-dependence of reporter phenotype to indicate cDNA-dependent interaction
Fuse LexA to the carboxyl terminus of the bait pNLexA – – – – + – Generally, LexA poorly tolerates attachment of the amino-terminal fusion domain; only ~60% of constructs are expressed correctly.
Integrate bait, reduce concentration pEG202I +? – – +? +? + Reduced bait protein concentration may lead to reduced assay sensitivity.
(+) Would usually help; (+?) may help; (–) will not help.
aAll of the alternative bait expression vectors remain on an AmpR selection for bacteria. If using them as is, the investigator may need to use a KC8 bacterial passage to isolate the library plasmid after a library screen.
Copyright © 2010 by Cold Spring Harbor Laboratory Press.Terms of Service. All rights reserved. Anyone using the procedures outlined in these protocols does so at their own risk. Cold Spring Harbor Laboratory makes no representations or warranties with respect to the material set forth in these protocols and has no liability in connection with their use. All materials used in these protocols, but not limited to those highlighted with the Warning icon, may be considered hazardous and should be used with caution. For a full listing of cautions,click here.
All rights reserved. No part of these pages, either text or images, may be used for any reason other than personal use. Reproduction, modification, storage in a retrieval system or retransmission, in any form or by any means-electronic, mechanical, or otherwise-for reasons other than personal use is strictly prohibited without prior written permission.
This article has been cited by other articles:
I. Serebriiskii
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 2: Transforming and Characterizing the Library
Cold Spring Harb Protoc, May 1, 2010; 2010(5): 10.1101/pdb.prot5430.
[Abstract][Full Text]
I. Serebriiskii
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 3: Screen for Interacting Proteins
Cold Spring Harb Protoc, May 1, 2010; 2010(5): 10.1101/pdb.prot5431.
[Abstract][Full Text]
I. Serebriiskii
Yeast Two-Hybrid System for Studying Protein-Protein Interactions--Stage 4: Isolation of Library Plasmid Insert and Second Confirmation of Positive Interactions
Cold Spring Harb Protoc, May 1, 2010; 2010(5): 10.1101/pdb.prot5432.
[Abstract][Full Text]